Sequence ID | >WENV170324671 |
Genome ID | CESS01096555 |
Search identical group | |
Phylum/Class | [CESS] marine metagenome genome assembly TARA_023_DCM_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 1164 |
End posion on genome | 1090 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
agctcggtgc |
tRNA gene sequence |
GGCCTCTTAGTTAAATGGATATAACGGCCCCCTCCTAAGGGGCAGTTGCAGGTTCGATTC |
Downstream region at tRNA end position |
attaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170324671 Arg CCT c ACCA attaaatcaa G + T G - C C - G C - G T + G C - G T - A T T T C G T C C A T A A A | | | | | G G A T T G G C A G G C G | | | | T T A T A A C T A G AGTT G - C C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |