Sequence ID | >WENV170325141 |
Genome ID | CESS01200172 |
Search identical group | |
Phylum/Class | [CESS] marine metagenome genome assembly TARA_023_DCM_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 315 |
End posion on genome | 388 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
atccaaacgt |
tRNA gene sequence |
GCCTTGGTAGCTCAGCCTGGTAGAGCACCTGATTCGTAATCAGTAGGTCGCGGGTTCAGA |
Downstream region at tRNA end position |
atattatatt |
Secondary structure (Cloverleaf model) | >WENV170325141 Thr CGT t Tttc atattatatt G - C C - G C - G T - A T - A G - C G + T T A T T G C C C G C G A A + | | | | A C C T C G G C G G G C T | | | | T T G G A G C G T A A AGGTC C T C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |