Sequence ID | >WENV170325499 |
Genome ID | CEST01025695 |
Search identical group | |
Phylum/Class | [CEST] marine metagenome genome assembly TARA_085_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 122 |
End posion on genome | 197 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gaatgttaat |
tRNA gene sequence |
GCCCTTGTAGCTCAGCTGGTAGAGCAATTGATTTGTAATCAATAGGTCCGCGGTTCGACT |
Downstream region at tRNA end position |
cattattttt |
Secondary structure (Cloverleaf model) | >WENV170325499 Thr TGT t ACCA cattattttt G - C C - G C - G C - G T + G T + G G - C T C T G T G C C A C G A A | + | | | G T C T C G C G C G G C G | | | | T T G G A G C T A A AGGTC A - T T - A T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |