The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0119
Genome IDCP000493
Search identical group
Phylum/ClassThermoproteota
SpeciesHyperthermus butylicus DSM 5456 [CP000493]
Start position on genome 1630705
End posion on genome 1630792
Amino Acid Leu
Anticodon CAG
Upstream region at tRNA start position
agcccaggct
tRNA gene sequence
GCGGGGGTGCCCGAGCCAGGTCAAAGGGGGCGGGCTCAGGACCCGCTGGCGTAGGCCTGC
GTGGGTTCAAATCCCACCCCCCGCACCA
Downstream region at tRNA end position
ccctcctctc
Secondary structure (Cloverleaf model)
>At0119	Leu	CAG
                   t      ACCA ccctcctctc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C A C C C     A
    C C G A        G      | | | | |     A
  A         G C C C       G T G G G     C
  G           | | |                 T T
  G         A G G G
    T C A A        G     TGGCGTAGGCCTGC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    C A G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGGGGTGCCCGAGCCAGGTCAAAGGGGGCGGGCTCAGGACCCGCTGGCGTAGGCCTGC
GTGGGTTCAAATCCCACCCCCCGCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK