Sequence ID | >WENV170328614 |
Genome ID | CESV01028650 |
Search identical group | |
Phylum/Class | [CESV] marine metagenome genome assembly TARA_100_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 29313 |
End posion on genome | 29386 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
atgggaaatt |
tRNA gene sequence |
GACTCGGTAGCTCAGCTGGTAGAGCAATACACTTTTAATGTATGGGTCCTGGGTTCGAAC |
Downstream region at tRNA end position |
ttttctctgc |
Secondary structure (Cloverleaf model) | >WENV170328614 Lys TTT t ACat ttttctctgc G - C A - T C - G T - A C - G G - C G - C C A T G A C C C A C G A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC A - T T - A A - T C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |