The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0126
Genome IDCP000493
Search identical group
Phylum/ClassThermoproteota
SpeciesHyperthermus butylicus DSM 5456 [CP000493]
Start position on genome 123181
End posion on genome 123103
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
atggatggct
tRNA gene sequence
GCGGCGGTCGTCTAGCCTGGACTAGGACGCCGGCCTGCCAAGCCGGCGATCCCGGGTTCA
AATCCCGGCCGCCGCACCA
Downstream region at tRNA end position
ccctcccctt
Secondary structure (Cloverleaf model)
>At0126	Gly	GCC
                   t      ACCA ccctcccctt
                     G - C
                     C - G
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        C      | | | | |     A
  T         T C T G       C C G G G     C
  G         + | | |                 T T
  G         G G A C
    A C T A        G     CGATC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    G C C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGCGGTCGTCTAGCCTGGACTAGGACGCCGGCCTGCCAAGCCGGCGATCCCGGGTTCA
AATCCCGGCCGCCGCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK