Sequence ID | >WENV170332764 |
Genome ID | CESX01004171 |
Search identical group | |
Phylum/Class | [CESX] marine metagenome genome assembly TARA_109_DCM_0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 188 |
End posion on genome | 262 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tacgcattag |
tRNA gene sequence |
GTCCCCATAGTTTAATGGATAAAACAAGGCCCTCCTAAGGCTTAGATGTTGGTTCGATTC |
Downstream region at tRNA end position |
ttaattgcgc |
Secondary structure (Cloverleaf model) | >WENV170332764 Arg CCT g GCCA ttaattgcgc G - C T - A C - G C - G C - G C - G A - T T T T C G A C C A T A A A | + | | | G G T T T G G T T G G C G | | | | T T A A A A C T A A AGAT A - T G + T G - C C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |