| Sequence ID | >WENV170333978 |
| Genome ID | CESY01115179 |
| Phylum/Class | [CESY] marine metagenome genome assembly TARA_098_MES_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
| Species | |
|
Start position on genome
|
195
|
|
End posion on genome
|
270
|
|
Amino Acid
|
Phe
|
|
Anticodon
|
GAA
|
|
Upstream region at tRNA start position
|
gattctttgg
|
|
tRNA gene sequence
|
GCCCAGGTAGCTCAGTTGGTAGAGCAGCGGACTGAAAATCCGCGTGTCGGTGGTTCGAGT CCGCCCCTGGGCACCA
|
|
Downstream region at tRNA end position
|
ttcttaatga
|
| Secondary structure (Cloverleaf model) | >WENV170333978 Phe GAA
g ACCA ttcttaatga
G - C
C - G
C - G
C - G
A - T
G - C
G - C T G
T C C G C C A
T G A A | | + | | G
T C T C G G G T G G C
G | | | | T T
G G A G C
T A A GTGTC
G - C
C - G
G - C
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |