The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0205
Genome IDAE009441
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum aerophilum str. IM2 [AE009441]
Start position on genome 1903980
End posion on genome 1904119
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
ccctcccccg
tRNA gene sequence
GCGGCGGTAGTCTAGCCTGGTTTAGGATGGCGGCCTGCCAAGCCGTTGATCCCGGGTTCA
AATCCCGGCCGCCGCACCA
Downstream region at tRNA end position
cgtttttctc
Secondary structure (Cloverleaf model)
>At0205	Gly	GCC
                   g      ACCA cgtttttctc
                     G - C
                     C - G
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  T         T C T G       C C G G G     C
  G         + | | +                 T T
  G         G G A T
    T T T A        G     TGATC
                    G + T
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    G C C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGgtgcggaaaaatttaaaaagatactgatacaagcttacggcaggccgccgccgcgtt
ggcgGCGGTAGTCTAGCCTGGTTTAGGATGGCGGCCTGCCAAGCCGTTGATCCCGGGTTC
AAATCCCGGCCGCCGCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK