Sequence ID | >At0245 |
Genome ID | CP000660 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Pyrobaculum arsenaticum DSM 13514 [CP000660] |
Start position on genome | 1582747 |
End posion on genome | 1582831 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agtggattca |
tRNA gene sequence |
GCCGGGGTGGCCGAGTTGGTCCAAGGCGCGGGCCTGCTAAGCCCGTCCCCGTTCGGGGGC |
Downstream region at tRNA end position |
ttccttgtac |
Secondary structure (Cloverleaf model) | >At0245 Ser GCT a Gctt ttccttgtac G - C C - G C - G G - C G - C G - C G - C T A T C A C C C A T T G A G | | | | | A G G C C G G T G G G C G | | | T T T A G G C C C A G TCCCCGTTCGGGGGC C - G G - C G - C G - C C - G C A T A G C T |
tRNA gene sequence including intron sequence (Lowercase is intron sequence.) | GCCGGGGTGGCCGAGTTGGTCCAAGGCGCGGGCCTGCTAAGCCCGTCCCCGTTCGGGGGC |
Intron | |
Final decision | ○ |
Comments | The tRNA gene was obtained from SPLITSdb. |
Genome/Seq. Info. | [Ensembl] |
SPLITSdb | [SPLITSdb] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |