Sequence ID | >WENV170340385 |
Genome ID | CETB01343616 |
Search identical group | |
Phylum/Class | [CETB] marine metagenome genome assembly TARA_112_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 852 |
End posion on genome | 927 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tccgccttat |
tRNA gene sequence |
TCCCCGGTAGCTCAGTCGGTAGAGCGGATGACTGTTAATCATTAGGTCGGCGGTTCGAGC |
Downstream region at tRNA end position |
tatcccacaa |
Secondary structure (Cloverleaf model) | >WENV170340385 Asn GTT t GCCA tatcccacaa T - A C - G C - G C - G C - G G - C G - C C G T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A G AGGTC G + T A - T T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |