Sequence ID | >WENV170340828 |
Genome ID | CETC01037664 |
Search identical group | |
Phylum/Class | [CETC] marine metagenome genome assembly TARA_122_DCM_0.1-0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 238 |
End posion on genome | 163 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccgttcggac |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGTAGGTTCGAAT |
Downstream region at tRNA end position |
tccgaaataa |
Secondary structure (Cloverleaf model) | >WENV170340828 Lys TTT c ACCA tccgaaataa G - C G - C G - C T - A C - G G - C T - A T A T C A T C C A T G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |