| Sequence ID | >WENV170340845 | 
| Genome ID | CETC01040161 | 
	| Phylum/Class | [CETC] marine metagenome genome assembly TARA_122_DCM_0.1-0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) | 
	| Species |  | 
	| Start position on genome | 1002 | 
	| End posion on genome | 1076 | 
	| Amino Acid | Gly | 
	| Anticodon | GCC | 
	| Upstream region at tRNA start position | 
ctcgagttca
 | 
	| tRNA gene sequence | 
GCGGGAATAGCTCAGTGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAATCTCGTTTCCCGCTCCA
 | 
	| Downstream region at tRNA end position | 
gtaacacagg
 | 
	| Secondary structure (Cloverleaf model) | >WENV170340845	Gly	GCC
                   a      TCCA gtaacacagg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     A - T          T A
                    T     T G C T C     A
        G A        A      + | | | |     G
      T     C T C G       G C G A G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     GGGTC
                    C - G
                    A - T
                    A - T
                    C - G
                    C - G
                  T       A
                  T       A
                    G C C
 | 
	| Intron |  | 
	
	| Comment/Decision |  | 
	
	| Genome/Seq. Info. | [ENA] |