The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0304
Genome IDCP000561
Search identical group
Phylum/ClassThermoproteota
SpeciesPyrobaculum calidifontis JCM 11548 [CP000561]
Start position on genome 1687978
End posion on genome 1688071
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
gaagctccca
tRNA gene sequence
GCGGCGGTAGTCTAGCCTGGTTTAGGATGGCGGCCTGCCAAGCCGTTGATCCCGGGTTCA
AATCCCGGCCGCCGCAtgc
Downstream region at tRNA end position
ccggtttcct
Secondary structure (Cloverleaf model)
>At0304	Gly	GCC
                   a      Atgc ccggtttcct
                     G - C
                     C - G
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  T         T C T G       C C G G G     C
  G         + | | +                 T T
  G         G G A T
    T T T A        G     TGATC
                    G + T
                    C - G
                   *G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    G C C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGCGGTAGTCTAGCCTGGTTTAGGATGGCGagggcgcagcccccacacGCCTGCCAAG
CCGTTGATCCCGGGTTCAAATCCCGGCCGCCGCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK