Sequence ID | >WENV170346472 |
Genome ID | CETG01043134 |
Search identical group | |
Phylum/Class | [CETG] marine metagenome genome assembly TARA_122_DCM_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 2417 |
End posion on genome | 2490 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gatctaacta |
tRNA gene sequence |
GCTCCCTTAGCTCAGCTGGATAGAGCAACTGCCTTCTAAGCAGTGGGCCGCTGGTTCGAA |
Downstream region at tRNA end position |
tcaaactact |
Secondary structure (Cloverleaf model) | >WENV170346472 Arg TCT a Gtat tcaaactact G - C C - G T - A C - G C - G C - G T - A T A T C G A C C A C G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C A T A A GGGCC A - T C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |