The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0408
Genome IDCP000575
Search identical group
Phylum/ClassThermoproteota
SpeciesStaphylothermus marinus F1 [CP000575]
Start position on genome 633338
End posion on genome 633251
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
atataatggt
tRNA gene sequence
GCGGGGGTGCCCGAGCCTGGTCAAAGGGGTCGGGCTTAGGACCCGATGGCGTAGGCCTGC
GTGGGTTCAAATCCCACCCCCCGCACCA
Downstream region at tRNA end position
taaaatgctt
Secondary structure (Cloverleaf model)
>At0408	Leu	TAG
                   t      ACCA taaaatgctt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C A C C C     A
    C C G A        G      | | | | |     A
  T         G C C C       G T G G G     C
  G           | | |                 T T
  G         A G G G
    T C A A        G     TGGCGTAGGCCTGC
                    T - A
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G
                    T A G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGGGGTGCCCGAGCCTGGTCAAAGGGGTCGGGCTTAGGACCCGATGGCGTAGGCCTGC
GTGGGTTCAAATCCCACCCCCCGCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK