The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0447
Genome IDCP000077
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfolobus acidocaldarius DSM 639 [CP000077]
Start position on genome 440438
End posion on genome 440363
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
atatctgcct
tRNA gene sequence
GCGGCCGTAGTCTAGCCTGGATTAGGACGCCTGCCTGCCACGCAGGAGGTCCCGGGTTCA
AATCCCGGCGGTCGCAttg
Downstream region at tRNA end position
tgggggatac
Secondary structure (Cloverleaf model)
>At0447	Gly	GCC
                   t      Attg tgggggatac
                     G - C
                     C - G
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  T         T C T G       C C G G G     C
  G         + | | |                 T T
  G         G G A C
    A T T A        G     AGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    C - G
                  C       C
                  T       A
                    G C C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGCCGTAGTCTAGCCTGGATTAGGACGCCTGCCTGCCACGCAGGAGGTCCCGGGTTCA
AATCCCGGCGGTCGCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK