The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0458
Genome IDCP000077
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfolobus acidocaldarius DSM 639 [CP000077]
Start position on genome 716550
End posion on genome 716448
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
tttgtgtctt
tRNA gene sequence
GCGGGGGTGCCCGAGCAAGGTCAAAGGGGTCGGGCTTAGGCCCCGATGGTGTAGGCCTGC
GTGGGTTCAAATCCCACCCCCCGCAttc
Downstream region at tRNA end position
ttgatcatag
Secondary structure (Cloverleaf model)
>At0458	Leu	TAG
                   t      Attc ttgatcatag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     C A C C C     A
    A C G A        G      | | | | |     A
  A         G C C C       G T G G G     C
  G           | | |                 T T
  G         A G G G
    T C A A        G     TGGTGTAGGCCTGC
                    T - A
                    C - G
                    G - C
                    G - C
                    G - C
                  C       C
                  T       G *
                    T A G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGGGGTGCCCGAGCAAGGTCAAAGGGGTCGGGCTTAGGaccccaaacgggtaagatCC
CCGATGGTGTAGGCCTGCGTGGGTTCAAATCCCACCCCCCGCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK