The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0476
Genome IDAE006641
Search identical group
Phylum/ClassThermoproteota
SpeciesSaccharolobus solfataricus P2 [AE006641]
Start position on genome 387197
End posion on genome 387272
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
attaaacagt
tRNA gene sequence
GCGGCCGTAGTCTAGCCTGGATTAGGACGCCTGCCTGCCACGCAGGAGGTCCCGGGTTCA
AATCCCGGCGGCCGCAtac
Downstream region at tRNA end position
aatacttttt
Secondary structure (Cloverleaf model)
>At0476	Gly	GCC
                   t      Atac aatacttttt
                     G - C
                     C - G
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  T         T C T G       C C G G G     C
  G         + | | |                 T T
  G         G G A C
    A T T A        G     AGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    C - G
                  C       C
                  T       A
                    G C C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGCCGTAGTCTAGCCTGGATTAGGACGCCTGCCTGCCACGCAGGAGGTCCCGGGTTCA
AATCCCGGCGGCCGCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK