The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0482
Genome IDAE006641
Search identical group
Phylum/ClassThermoproteota
SpeciesSaccharolobus solfataricus P2 [AE006641]
Start position on genome 664870
End posion on genome 664954
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
tttataatgc
tRNA gene sequence
GCGGGGGTGCCCGAGCTAGGTCAAAGGGGGCAGGCTTAGGCCCTGCTGGCGAAGGCCTGC
ACGGGTTCAAATCCCGTCCCCCGCActg
Downstream region at tRNA end position
tttttaaact
Secondary structure (Cloverleaf model)
>At0482	Leu	TAG
                   c      Actg tttttaaact
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     T G C C C     A
    T C G A        G      | | | | |     A
  A         G C C C       A C G G G     C
  G           | | |                 T T
  G         A G G G
    T C A A        G     TGGCGAAGGCCTGC
                    G - C
                    C - G
                    A - T
                    G - C
                    G - C
                  C       C
                  T       G
                    T A G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGGGGTGCCCGAGCTAGGTCAAAGGGGGCAGGCTTAGGCCCTGCTGGCGAAGGCCTGC
ACGGGTTCAAATCCCGTCCCCCGCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK