Sequence ID | >At0495 |
Genome ID | AE006641 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Saccharolobus solfataricus P2 [AE006641] |
Start position on genome | 185227 |
End posion on genome | 185144 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atagtagagt |
tRNA gene sequence |
GCCGGGGTGCCCGAGCGGACTAAGGGGCTGGCCTGGAGAGCCAGTGGGGGTTTCCCCGCG |
Downstream region at tRNA end position |
tttaaattta |
Secondary structure (Cloverleaf model) | >At0495 Ser GGA t Gcta tttaaattta G - C C - G C - G G - C G - C G - C G - C T A T C G C C C A C G A G | | | | | A G G C C C G C G G G C G | | | T T A A G G G C T A G TGGGGGTTTCCCCGC C - G T - A G - C G - C C - G C A T G G G A |
tRNA gene sequence including intron sequence (Lowercase is intron sequence.) | GCCGGGGTGCCCGAGCGGACTAAGGGGCTGGCCTGGAGAGCCAGTGGGGGTTTCCCCGCG |
Intron | |
Final decision | ○ |
Comments | The tRNA gene was obtained from SPLITSdb. |
Genome/Seq. Info. | [Ensembl] |
SPLITSdb | [SPLITSdb] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |