The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0533
Genome IDBA000023
Search identical group
Phylum/ClassThermoproteota
SpeciesSulfurisphaera tokodaii str. 7 [BA000023]
Start position on genome 1719268
End posion on genome 1719343
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
tatccttagt
tRNA gene sequence
GCGGCCGTAGTCTAGCCTGGATTAGGACGCCGGCCTGCCACGCCGGAGGTCCCGGGTTCA
AATCCCGGCGGTCGCActg
Downstream region at tRNA end position
tggggggtcc
Secondary structure (Cloverleaf model)
>At0533	Gly	GCC
                   t      Actg tggggggtcc
                     G - C
                     C - G
                     G - C
                     G + T
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
    C C G A        A      | | | | |     A
  T         T C T G       C C G G G     C
  G         + | | |                 T T
  G         G G A C
    A T T A        G     AGGTC
                    C - G
                    C - G
                    G - C
                    G - C
                    C - G
                  C       C
                  T       A
                    G C C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGCCGTAGTCTAGCCTGGATTAGGACGCCGGCCTGCCACGCCGGAGGTCCCGGGTTCA
AATCCCGGCGGTCGCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK