The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0580
Genome IDCP000505
Search identical group
Phylum/ClassThermoproteota
SpeciesThermofilum pendens Hrk 5 [CP000505]
Start position on genome 643896
End posion on genome 643983
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
ctaccggaaa
tRNA gene sequence
GCGGGGGTGCCCGAGCTAGGACAAAGGGGGCGGACTTAGGCTCCGCTGGCGAAGGCCTGC
CCGGGTTCGAATCCCGGCCCCCGCACCA
Downstream region at tRNA end position
cttctttggt
Secondary structure (Cloverleaf model)
>At0580	Leu	TAG
                   a      ACCA cttctttggt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     G G C C C     A
    T C G A        G      | | | | |     G
  A         G C C C       C C G G G     C
  G           | | |                 T T
  G         A G G G
    A C A A        G     TGGCGAAGGCCTGC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  C       C
                  T       G
                    T A G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGGGGTGCCCGAGCTAGGACAAAGGGGGCGGACTTAGGCTCCGCTGGCGAAGGCCTGC
CCGGGTTCGAATCCCGGCCCCCGCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK