The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0583
Genome IDCP000505
Search identical group
Phylum/ClassThermoproteota
SpeciesThermofilum pendens Hrk 5 [CP000505]
Start position on genome 796113
End posion on genome 796209
Amino Acid Gly
Anticodon GCC
Upstream region at tRNA start position
ttgaactttg
tRNA gene sequence
GCGGCCGTAGTCTAGTCTGGTAGGATGGCGGCCTGCCACGCCGCAGAACCCGGGTTCAAA
TCCCGGCGGCCGCACCA
Downstream region at tRNA end position
ctttttcacg
Secondary structure (Cloverleaf model)
>At0583	Gly	GCC
                   g      ACCA ctttttcacg
                     G - C
                     C - G
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G G C C C     A
      T G A        A      | | | | |     A
    C       T C T G       C C G G G     C
    T       + | | +                 T T
    G       G G A T
      G T A        G     AGAAC
                    G - C
                    C - G
                    G - C
                    G - C
                    C - G
                  C       C
                  T       A
                    G C C
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGCCGTAGTCTAGTCTGGTAGGATGGCGGCCTGCCACGCCGCAGagccctgtgtaggc
gcggagAACCCGGGTTCAAATCCCGGCGGCCGCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK