The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0593
Genome IDCP000505
Search identical group
Phylum/ClassThermoproteota
SpeciesThermofilum pendens Hrk 5 [CP000505]
Start position on genome 426125
End posion on genome 425998
Amino Acid Leu
Anticodon CAG
Upstream region at tRNA start position
agacgcgcgg
tRNA gene sequence
GCGGGGGTGCCCGAGCTAGGTCAAAGGGGGCGGACTCAGGCTCCGCTGGCGTTGGCCTGC
CCGGGTTCGAATCCCGGCCCCCGCACCA
Downstream region at tRNA end position
ctctccctgg
Secondary structure (Cloverleaf model)
>At0593	Leu	CAG
                   g      ACCA ctctccctgg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     G - C          T A
                    T     G G C C C     A
    T C G A        G      | | | | |     G
  A         G C C C       C C G G G     C
  G           | | |                 T T
  G         A G G G
    T C A A        G     TGGCGTTGGCCTGC
                    G - C
                    C - G
                    G - C
                   *G - C
                    A - T
                  C       C
                  T       G
                    C A G
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GCGGGGGTGCCCGAGCTAGGTCAAAGGGGGCGGaccggcctggaggctgggcctatACTC
AGGattacattcaatgggagCTCCGCTGGCGTTGGCCTGCCCGGGTTCGAATCCCGGCCC
CCGCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK