Sequence ID | >WENV170380231 |
Genome ID | CETW01016490 |
Search identical group | |
Phylum/Class | [CETW] marine metagenome genome assembly TARA_052_DCM_0.22-1.6 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 428 |
End posion on genome | 355 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aggaaggttc |
tRNA gene sequence |
GCGGGCATAGTTCAACGGTAGAACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ggctgtggtg |
Secondary structure (Cloverleaf model) | >WENV170380231 Gly TCC c TCCA ggctgtggtg G - C C - G G - C G - C G - C C - G A - T T T T C G C C C A A A A | | | | | G C C T T G G C G G G C G | | | | T T G G A A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |