The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0656
Genome IDCP000780
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanoregula boonei 6A8 [CP000780]
Start position on genome 742580
End posion on genome 742751
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
catgacgggc
tRNA gene sequence
GGGGTTGTGGCCAAGCCCGGAATGGCGACGGGCTCCAGACCCGTCGATCGTGAGTTCAAA
TCTCACCAACCCCAcgt
Downstream region at tRNA end position
tttccagaac
Secondary structure (Cloverleaf model)
>At0656	Trp	CCA
                   c      Acgt tttccagaac
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     T - A
                     G - C          T A
                    T     C A C T C     A
      C G A        G      | | | | |     A
    C       A C C G       G T G A G     C
    C       | | | |                 T T
    G       T G G C
      G A A        G     CGATC
                    A - T
                    C - G
                    G - C
                    G - C
                    G - C
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGTTGTGGCCAAGCCCGGAATGGCGACGGGCTCCAGcggtctttgcgttcaaaaaacg
tgctcgcagatgatgaacaatgggtctgctgaaattgatgatgacccgttggagcactga
tgcgcatgtcggagagACCCGTCGATCGTGAGTTCAAATCTCACCAACCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK