Sequence ID | >WENV170384666 |
Genome ID | CETY01004821 |
Search identical group | |
Phylum/Class | [CETY] marine metagenome genome assembly TARA_133_DCM_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 7151 |
End posion on genome | 7066 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttttattttT |
tRNA gene sequence |
GGGAGAGTGGTGGAATGGTAGACACGACGGACTTAAAATCCGTTGGCTTTTGCGGCCGTG |
Downstream region at tRNA end position |
tatccaatat |
Secondary structure (Cloverleaf model) | >WENV170384666 Leu TAA T ATtt tatccaatat G + T G - C G - C A - T G - C A - T G - C T G T C T C C C A T A A G | | | | | A G G G T G G A G G G C G | | | T T T A C A C A G G TGGCTTTTGCGGCCGT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |