The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0749
Genome IDAY596297
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHaloarcula marismortui ATCC 43049 [AY596297, AY596298]
Start position on genome 646395
End posion on genome 646575
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
gccggagtgc
tRNA gene sequence
GGGGTCGTGGCCTAGTCCGGGAAGGCGGCTGACTCCAGATCAGCCGATCGGGGGTTCAAA
TCCCTCCGACCCCAttt
Downstream region at tRNA end position
cctgccgcga
Secondary structure (Cloverleaf model)
>At0749	Trp	CCA
                   c      Attt cctgccgcga
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | + | | |     A
    C       T C C G       G G G G G     C
    C       | | | |                 T T
    G       A G G C
      G G A        G     CGATC
                    G - C
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGTCGTGGCCTAGTCCGGGAAGGCGGCTGACTCCAGaggccacgcgcctgggacgaca
ctccaagggctgatatactgagcggccggctgatcaccggttcgcgacgatgaccctctg
gagttccgaggcgcaggacggagatATCAGCCGATCGGGGGTTCAAATCCCTCCGACCCC
A
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK