The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0801
Genome IDAE004437
Search identical group
Phylum/ClassEuryarchaeota
SpeciesHalobacterium salinarum NRC-1; ATCC 700922 [AE004437]
Start position on genome 770516
End posion on genome 770691
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
tggaatgcac
tRNA gene sequence
GGGGCTGTGGCCAAGCCAGGCATGGCGACTGACTCCAGATCAGTCGATCGGGGGTTCAAA
TCCCTCCGGCCCCAtac
Downstream region at tRNA end position
ccttacttca
Secondary structure (Cloverleaf model)
>At0801	Trp	CCA
                   c      Atac ccttacttca
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     G - C          T A
                    T     C T C C C     A
      C G A        G      | + | | |     A
    C       A C C G       G G G G G     C
    A       | | | |                 T T
    G       T G G C
      G C A        G     CGATC
                    A - T
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGCTGTGGCCAAGCCAGGCATGGCGACTGACTCCAGaggcccgcgcccgggacgacgc
tccagactggtataccgagcggccgactgatcatcggtccgctgtgacgaccctctggag
ttccgaggcgcaccggagatATCAGTCGATCGGGGGTTCAAATCCCTCCGGCCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK