Sequence ID | >At0835 |
Genome ID | AE004437 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halobacterium salinarum NRC-1; ATCC 700922 [AE004437] |
Start position on genome | 1542102 |
End posion on genome | 1542021 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ggaggactgg |
tRNA gene sequence |
GCCGGGATGGCCGAATGGCAAAGCGCACGCCTGGAAAGCGTGTCCCCTTACGGGGTTCAG |
Downstream region at tRNA end position |
ctcgcgatag |
Secondary structure (Cloverleaf model) | >At0835 Ser GGA g Gttt ctcgcgatag G - C C - G C - G G - C G - C G - C A - T T A T G T C C C A A A G | | | | | A T G C C G C A G G G C G | | T T G A A G C C A G TCCCCTTACGGGGTT C - G A - T C - G G - C C - G C A T A G G A |
tRNA gene sequence including intron sequence (Lowercase is intron sequence.) | GCCGGGATGGCCGAATGGCAAAGCGCACGCCTGGAAAGCGTGTCCCCTTACGGGGTTCAG |
Intron | |
Final decision | ○ |
Comments | The tRNA gene was obtained from SPLITSdb. |
Genome/Seq. Info. | [Ensembl] |
SPLITSdb | [SPLITSdb] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |