| Sequence ID | >WENV170403225 |
| Genome ID | CEUF01051280 |
| Phylum/Class | [CEUF] marine metagenome genome assembly TARA_138_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
| Species | |
|
Start position on genome
|
3039
|
|
End posion on genome
|
3115
|
|
Amino Acid
|
Pro
|
|
Anticodon
|
TGG
|
|
Upstream region at tRNA start position
|
aaagtttgag
|
|
tRNA gene sequence
|
CGGGGTGTAGCGCAGTCTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGGGAGTTCGAA TCTCTCCACCCCGACCA
|
|
Downstream region at tRNA end position
|
caaaaatata
|
| Secondary structure (Cloverleaf model) | >WENV170403225 Pro TGG
g ACCA caaaaatata
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T C T C T C A
T G A A | + | | | G
C C G C G G G G A G C
T | | | | T T
G G C G C
G T A A GGGTC
T - A
C - G
T - A
G - C
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |