The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At0945
Genome IDL77117
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanocaldococcus jannaschii DSM 2661 [L77117]
Start position on genome 1189945
End posion on genome 1190055
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
acattgatgc
tRNA gene sequence
GGGGGTGTGGTGTAGCCAGGTCTATCATCGGGGACTCCAGATCCCTGGACCTGGGTTCAA
ATCCCAGCACCCCCACCA
Downstream region at tRNA end position
ttttttaaat
Secondary structure (Cloverleaf model)
>At0945	Trp	CCA
                   c      ACCA ttttttaaat
                     G - C
                     G - C
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T A
                    T     G A C C C     A
    C C G A        G      | | | | |     A
  A         T G T G       C T G G G     C
  G           | | +                 T T
  G         T C A T
    T C T A        C     GGAC
                    G + T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       G *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGGTGTGGTGTAGCCAGGTCTATCATCGGGGACTCCAGttgcctatagggcgctggac
cacggcaggagaaATCCCTGGACCTGGGTTCAAATCCCAGCACCCCCACCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK