Sequence ID | >At0946 |
Genome ID | L77117 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanocaldococcus jannaschii DSM 2661 [L77117] |
Start position on genome | 1313165 |
End posion on genome | 1313249 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgcttttatt |
tRNA gene sequence |
GCGGGGGTGGCCCAGCCTGGTACGGCGTGGGACTGCTAATCCCATTGGGCAACGCCCAGC |
Downstream region at tRNA end position |
tctattttag |
Secondary structure (Cloverleaf model) | >At0946 Ser GCT t Gtca tctattttag G - C C - G G - C G - C G - C G - C G - C T G T G G C C C A C G A G | | | | | A C C C C G C C G G G C T | | | T T G C G G C G T A G TTGGGCAACGCCCAGC T - A G - C G - C G - C A - T C A T A G C T |
tRNA gene sequence including intron sequence (Lowercase is intron sequence.) | GCGGGGGTGGCCCAGCCTGGTACGGCGTGGGACTGCTAATCCCATTGGGCAACGCCCAGC |
Intron | |
Final decision | ○ |
Comments | The tRNA gene was obtained from SPLITSdb. |
Genome/Seq. Info. | [Ensembl] |
SPLITSdb | [SPLITSdb] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |