Sequence ID | >WENV170407499 |
Genome ID | CEUH01141344 |
Search identical group | |
Phylum/Class | [CEUH] marine metagenome genome assembly TARA_137_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 467 |
End posion on genome | 544 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gcttgctaaa |
tRNA gene sequence |
GGGTCATTAACTCAGTTGGTTCAGAGTGTTACCTTGACAGGGTAGAAGTCACTGGTTCGA |
Downstream region at tRNA end position |
aaataatcta |
Secondary structure (Cloverleaf model) | >WENV170407499 Val GAC a ACAA aaataatcta G - C G - C G - C T - A C - G A - T T - A T A T T G A C C A T T G A A | | | | | G G C T C A A C T G G C G | | | | T T T G A G T T C A G AAGTC T + G T - A A - T C - G C - G T G T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |