Sequence ID | >WENV170408651 |
Genome ID | CEUI01051030 |
Search identical group | |
Phylum/Class | [CEUI] marine metagenome genome assembly TARA_125_MIX_0.1-0.22 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 1559 |
End posion on genome | 1636 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aaactcgcaT |
tRNA gene sequence |
GGGTCTATAGCGCAGCCAGGTAGCGCACCGCCCTTTTAAGGCGGCTGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
ctattgtggt |
Secondary structure (Cloverleaf model) | >WENV170408651 Lys TTT T GTCC ctattgtggt G - C G - C G - C T - A C - G T - A A - T T A T C A C C C A C G A A | | | | | G C C G C G G T G G G C A | | | | T T G G C G C G T A A CTGTC C - G C - G G - C C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |