| Sequence ID | >WENV170410572 |
| Genome ID | CEUJ01114111 |
| Phylum/Class | [CEUJ] marine metagenome genome assembly TARA_125_MIX_0.22-0.45 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
| Species | |
|
Start position on genome
|
638
|
|
End posion on genome
|
566
|
|
Amino Acid
|
Thr
|
|
Anticodon
|
GGT
|
|
Upstream region at tRNA start position
|
ttagatagat
|
|
tRNA gene sequence
|
GCCCATATAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCACCGGTTCAAAT CCGGTTATGGGCTatt
|
|
Downstream region at tRNA end position
|
tttatcagat
|
| Secondary structure (Cloverleaf model) | >WENV170410572 Thr GGT
t Tatt tttatcagat
G - C
C - G
C - G
C - G
A - T
T - A
A - T T A
T T G G C C A
T G A A | | | | | A
C C T C G A C C G G C
G | | | | T T
G G A G C
T A A AGGTC
C - G
T - A
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |