Sequence ID | >At1008 |
Genome ID | CP000743 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanococcus aeolicus Nankai-3 [CP000743] |
Start position on genome | 281817 |
End posion on genome | 281901 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agtgagtagt |
tRNA gene sequence |
GCGGAGATGGCCCAGTCTGGTACGGCGCGGGACTGCTAATCCCGTTGGGCTTTGCCCAAC |
Downstream region at tRNA end position |
tatttttaag |
Secondary structure (Cloverleaf model) | >At1008 Ser GCT t Gttt tatttttaag G - C C - G G - C G - C A - T G - C A - T T A T G G C T C A T G A G | | | | | A C C C C G C C G A G C T | | | T T G C G G C G T A G TTGGGCTTTGCCCAAC C - G G - C G - C G - C A - T C A T A G C T |
tRNA gene sequence including intron sequence (Lowercase is intron sequence.) | GCGGAGATGGCCCAGTCTGGTACGGCGCGGGACTGCTAATCCCGTTGGGCTTTGCCCAAC |
Intron | |
Final decision | ○ |
Comments | The tRNA gene was obtained from SPLITSdb. |
Genome/Seq. Info. | [Ensembl] |
SPLITSdb | [SPLITSdb] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |