Sequence ID | >At1022 |
Genome ID | CP000743 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanococcus aeolicus Nankai-3 [CP000743] |
Start position on genome | 1294050 |
End posion on genome | 1294124 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tattactgtg |
tRNA gene sequence |
GCCGGTGTAGGGTAGTGGTTATCCTGAAGGACTGTGGATCCTTCGACCCGGGTTCGATTC |
Downstream region at tRNA end position |
ttactttttt |
Secondary structure (Cloverleaf model) | >At1022 His GTG g CCCA ttactttttt G - C C - G C - G G - C G - C T - A G - C T T T G G C T C A T G A A | | | + | G G T G G G C C G G G C G | | + T T T T C C T T A G CGAC A - T A - T G - C G - C A - T C A T G G T G |
tRNA gene sequence including intron sequence (Lowercase is intron sequence.) | GCCGGTGTAGGGTAGTGGTTATCCTGAAGGACTGTGGATCCTTCGACCCGGGTTCGATTC |
Intron | |
Final decision | ○ |
Comments | The tRNA gene was obtained from SPLITSdb. |
Genome/Seq. Info. | [Ensembl] |
SPLITSdb | [SPLITSdb] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |