The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1043
Genome IDCP000743
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus aeolicus Nankai-3 [CP000743]
Start position on genome 1449341
End posion on genome 1449227
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
atttgttttc
tRNA gene sequence
GGGGATATGGTGTAGCCTGGCCTATCATTGGGGACTCCAAATCCCTAGACCTGGGTTCAA
ATCCCAGTATCCCCAtat
Downstream region at tRNA end position
tatttttttt
Secondary structure (Cloverleaf model)
>At1043	Trp	CCA
                   c      Atat tatttttttt
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T
                     T - A
                     A - T          T A
                    T     G A C C C     A
    C C G A        G      | | | | |     A
  T         T G T G       C T G G G     C
  G           | | +                 T T
  G         T C A T
    C C T A        T     AGAC
                    G + T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGGATATGGTGTAGCCTGGCCTATCATTGGGGACTCCAAgtgcctatatggatttggac
taaaacctaatgcaggagaaATCCCTAGACCTGGGTTCAAATCCCAGTATCCCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK