Sequence ID | >WENV170415560 |
Genome ID | CEUL01049917 |
Search identical group | |
Phylum/Class | [CEUL] marine metagenome genome assembly TARA_124_MIX_0.22-0.45 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 3687 |
End posion on genome | 3771 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gtatttatat |
tRNA gene sequence |
GCGGATGTGGTGAAATTGGTAGACACGCTAGATTTAGGTTCTAGTGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
tttgtaagga |
Secondary structure (Cloverleaf model) | >WENV170415560 Leu TAG t ACCA tttgtaagga G - C C - G G - C G - C A - T T - A G - C T G T T T C C C A T A A G + + | | | A T A G T G G G G G G C G | | | T T G A C A C T A G G TGCCGCAAGGCGT C - G T - A A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |