Sequence ID | >WENV170419445 |
Genome ID | CEUM01127560 |
Search identical group | |
Phylum/Class | [CEUM] marine metagenome genome assembly TARA_123_SRF_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 17172 |
End posion on genome | 17246 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
atatacatgc |
tRNA gene sequence |
TGGGGCGTCGTCAAGTGGTAAGACATCAGGTTTTGGTCCTGACATTCGGGGGTTCAAATC |
Downstream region at tRNA end position |
ctttttccat |
Secondary structure (Cloverleaf model) | >WENV170419445 Gln TTG c GCCA ctttttccat T - A G - C G - C G - C G - C C - G G - C T A T C C T C C A G A C | | + | | A T A C T G G G G G G C G | | | T T G A G A C T A A CATTC T - A C - G A - T G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |