The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1113
Genome IDCP000745
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis [CP000745]
Start position on genome 922165
End posion on genome 922002
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
atgtgcaata
tRNA gene sequence
GGGAGTATGGTGTAGTCTGGTCTATCATCGGGGACTCCAAATCCCTGGACCTGGGTTCAA
ATCCCAGTACTTCCActt
Downstream region at tRNA end position
tttttctttt
Secondary structure (Cloverleaf model)
>At1113	Trp	CCA
                   a      Actt tttttctttt
                     G - C
                     G - C
                     G + T
                     A - T
                     G - C
                     T - A
                     A - T          T A
                    T     G A C C C     A
    C T G A        G      | | | | |     A
  T         T G T G       C T G G G     C
  G           | | +                 T T
  G         T C A T
    T C T A        C     GGAC
                    G + T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGAGTATGGTGTAGTCTGGTCTATCATCGGGGACTCCAAgtgcctatatggccttctta
agaatctaaggatttttaaggcgcacaaacacaagtttgttgcgtggactaaagcccgat
gcaggagaaATCCCTGGACCTGGGTTCAAATCCCAGTACTTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK