Sequence ID | >WENV170422236 |
Genome ID | CEUN01144875 |
Search identical group | |
Phylum/Class | [CEUN] marine metagenome genome assembly TARA_124_MIX_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 666 |
End posion on genome | 582 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcaatcgact |
tRNA gene sequence |
GCGGGTGTGGCGAAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
agtttcacaa |
Secondary structure (Cloverleaf model) | >WENV170422236 Leu TAG t ACCA agtttcacaa G - C C - G G - C G - C G - C T - A G - C T G T C T C C C A T A A G | + | | | A T A G C G G G G G G C G | | | T T G A C G C T A G A CGCCGCAAGGCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |