Sequence ID | >WENV170426110 |
Genome ID | CEUQ01052239 |
Search identical group | |
Phylum/Class | [CEUQ] marine metagenome genome assembly TARA_124_MIX_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 3284 |
End posion on genome | 3212 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cccatggcac |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGTAGAGCGCTGCCTTTGCAAGGCAGACGTCAGCGGTTCGAGT |
Downstream region at tRNA end position |
aaagatcttt |
Secondary structure (Cloverleaf model) | >WENV170426110 Ala TGC c Agcc aaagatcttt G - C G - C G + T G - C G - C T - A A - T T G T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G ACGTC C - G T - A G - C C - G C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |