The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1155
Genome IDBX950229
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus maripaludis S2 [BX950229]
Start position on genome 1627676
End posion on genome 1627513
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
atgtgcaata
tRNA gene sequence
GGGAGTATGGTGTAGTCTGGTCTATCATCGGGGACTCCAAATCCCTGGACCTGGGTTCAA
ATCCCAGTACTTCCActt
Downstream region at tRNA end position
tttttctttt
Secondary structure (Cloverleaf model)
>At1155	Trp	CCA
                   a      Actt tttttctttt
                     G - C
                     G - C
                     G + T
                     A - T
                     G - C
                     T - A
                     A - T          T A
                    T     G A C C C     A
    C T G A        G      | | | | |     A
  T         T G T G       C T G G G     C
  G           | | +                 T T
  G         T C A T
    T C T A        C     GGAC
                    G + T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGAGTATGGTGTAGTCTGGTCTATCATCGGGGACTCCAAgtgcctatatggccttctta
gaaatctaagaatttttaaggcgcgcaaacaccagtttgttgcgtggactaaagcccgat
gcaggagaaATCCCTGGACCTGGGTTCAAATCCCAGTACTTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK