The detailed information of tRNA gene sequence


[Important Notice]
tRNA genes in Archaeal genomes were obtained from "SPLITSdb" (1, 2).
1. Sugahara et al. In Silico Biology, "6, 0039, 2006".
2. Sugahara et al. Molecular Biology and Evolution, "25, 2709-2716, 2008".

Sequence ID>At1189
Genome IDCP000742
Search identical group
Phylum/ClassEuryarchaeota
SpeciesMethanococcus vannielii SB [CP000742]
Start position on genome 1004623
End posion on genome 1004459
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
tgtaagttac
tRNA gene sequence
GGGAGTATAGTGTAGACTGGCCCATCATCGGGGACTCCAAATCCCTGGACCTGGGTTCAA
ATCCCAGTACTTCCActt
Downstream region at tRNA end position
tttttagaca
Secondary structure (Cloverleaf model)
>At1189	Trp	CCA
                   c      Actt tttttagaca
                     G - C
                     G - C
                     G + T
                     A - T
                     G - C
                     T - A
                     A - T          T A
                    T     G A C C C     A
    C A G A        A      | | | | |     A
  T         T G T G       C T G G G     C
  G           | | +                 T T
  G         T C A T
    C C C A        C     GGAC
                    G + T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A *
                    C C A
tRNA gene sequence including intron sequence (Lowercase is intron sequence.)
GGGAGTATAGTGTAGACTGGCCCATCATCGGGGACTCCAAgtgcctatatggacttctta
aaaagcagggatgctttttaaggcgcacaaaactattttgttgcgtggactaaatcccga
tgcaggagaaATCCCTGGACCTGGGTTCAAATCCCAGTACTTCCA
Intron
Final decision
CommentsThe tRNA gene was obtained from SPLITSdb.
Genome/Seq. Info.[Ensembl]
SPLITSdb[SPLITSdb]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK