Sequence ID | >WENV170435226 |
Genome ID | CEUS01364712 |
Search identical group | |
Phylum/Class | [CEUS] marine metagenome genome assembly TARA_125_MIX_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 17 |
End posion on genome | 92 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaattttcga |
tRNA gene sequence |
GGGCTCGTAGCTCAGCTTGGCTAGAGCGTTCGACTGATAATCGAAAGGCCATGAGTTCGA |
Downstream region at tRNA end position |
tgtattctaa |
Secondary structure (Cloverleaf model) | >WENV170435226 Ile GAT a ACtt tgtattctaa G - C G - C G - C C - G T + G C - G G - C T A T T A C T C A T C G A A | | | | | G T C T C G A T G A G C G | | | | T T G G A G C C T A G AGGCC T - A T - A C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |