Sequence ID | >WENV170437743 |
Genome ID | CEUU01063906 |
Search identical group | |
Phylum/Class | [CEUU] marine metagenome genome assembly TARA_122_SRF_0.45-0.8 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 400 |
End posion on genome | 473 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
taatgagtta |
tRNA gene sequence |
CGGGGCGTAGCGCAGTTTGGTAGCGCACCACTTTGGGGTAGTGGGGGTCGTGGGTTCAAA |
Downstream region at tRNA end position |
taatctctat |
Secondary structure (Cloverleaf model) | >WENV170437743 Pro GGG a Atat taatctctat C - G G - C G - C G + T G + T C - G G - C T A T C G C C C A T G A A | + | | | A T C G C G G T G G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G A - T C - G T - A T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |