Sequence ID | >WENV170439447 |
Genome ID | CEUV01033388 |
Search identical group | |
Phylum/Class | [CEUV] marine metagenome genome assembly TARA_123_SRF_0.22-3 ,contig; saline water (ENVO:00002010), including plankton (ENVO:xxxxxxxx) |
Species | |
Start position on genome | 11781 |
End posion on genome | 11856 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taatttctaa |
tRNA gene sequence |
GCTGGTGTAGCTCAATTGGTAGAGCAACTGATTTGTAATCAGTCGGTTATGAGTTCAAGT |
Downstream region at tRNA end position |
acaaatttaa |
Secondary structure (Cloverleaf model) | >WENV170439447 Thr TGT a TCTA acaaatttaa G - C C - G T - A G + T G - C T - A G - C T G T T T C T C A T A A A | | | | A T C T C G A T G A G C G | | | | T T G G A G C T A A CGGTT A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |